[Fusobacterium nucleatum isolated from a patient presenting lachrymal canaliculitis]. / Fusobacterium nucleatum isolé chez un patient présentant une canaliculite.

A 68-year-old woman presented with a painless inflammation of the right superior eyelid that had started several weeks before. The clinical diagnosis concluded in canaliculitis and the solid concretions were surgically extracted from the superior canalicula. The anaerobic bacteria Fusobacterium nucleatum sp. nucleatum was isolated. Signs dramatically regressed two weeks after surgery followed by one course of oral amoxicillin and clavulanic acid associated with topical tobramycin. The clinical signs had disappeared two months later.

[New ultra rapid test for detection of bacteria]. / Nouveau test ultrarapide pour la détection de bactéries.

INTRODUCTION: Bacteriological testing is aimed to reduce the risk of transmission of infections. However, the detection of Bacteria by culture requires from 18hours to 14 days and may produce erroneous results for fastidious species. The goal of this work was to design and validate a new tool for bacterial testing. METHODS: The test is based on the fast real-time PCR (frt PCR). The DNA extracted from samples containing internal controls are introduced into four tubes containing primers and probes for the frt PCR. The cycling program consists in 1×at 95°C for 10min and 45×(15s at 95°C, 8s) at 52°C and 10s at 72°C. RESULTS: The frt PCR detects 0,01 CFU/µl of Bacteria and identifies eight Genera without interferences from the environment or from fungi and with no need for melting curve analysis or additional sequencing. DISCUSSION: The frt PCR detects and quantifies Bacteria identifying and assessing the load of Staphylococci, Streptococci, Haemophilus, Pseudomonas, Enterobacteria, Acinetobacter, Propionibacteriacae and Corynebacteria. CONCLUSION: Cultures require at least 24hours but the new frt PCR reduces the time to 90minutes. Larger series of samples are necessary to confirm the usefulness of this new test for routine bacterial sterility controls.

New tool for the simultaneous detection of 10 different genotypes of Acanthamoeba available from the American Type Culture Collection.

BACKGROUND: Acanthamoeba keratitis (AK) is a sight-threatening infection, and none of the current diagnosis tests are able to detect in one reaction low levels of the vast majority of strains associated with pathology. The goal of this work was to validate a new tool for the detection of the American Type Cell Collection (ATCC) referenced Acanthamoeba monitoring simultaneously DNA extraction yields and PCR inhibitors. Performances were assessed on corneal scrapings. METHODS: Primers were selected in a region bracketing a 41 591 bp of the A castellanii mitochondrion gene. DNA extraction and PCR inhibitors were monitored by adding an internal control (virus). Acanthamoeba were detected and quantified by the real-time fast-duplex TaqMan PCR (f-d-real-t PCR) and negativity confirmed by SYBR Green real-time PCR. RESULTS: The f-d-real-t PCR detects 0.1 cyst/microl or less of the 10 referenced strains (sensitivity slightly lower for A astronyxis). Bacteria, fungi and herpesviruses do not cross-react. The specificity and sensitivity of the f-d-real-t PCR were higher than culture and other real-time PCR on 20 keratitis samples. CONCLUSION: The f-d-real t PCR detects in less than 2 h the Acanthamoeba strains available from the ATCC with a higher sensitivity and specificity than techniques previously reported. Larger trials are necessary to validate its usefulness for disease management and environmental studies.

New test for the diagnosis of bacterial endophthalmitis.

BACKGROUND: Diagnosis of bacterial endophthalmitis (BE) often fails due to: (1) insufficient volumes of vitreous fluid (VF) and aqueous humour (AH); (2) lack of sensitivity of culture; (3) antibiotic treatments; (4) polymerase chain reaction (PCR) cross-contamination; and (5) limitations on the interpretation of the real-time PCR melting curve. We developed a fast real-time (f-real-t) PCR to improve the performance of the laboratory diagnosis of BE. METHODS: The following samples were processed after adding an internal control: phosphate buffered saline (PBS); VF, AH and cell suspensions spiked with Bacteria (Bac); VF and AH from patients with endophthalmitis; and VF and AH from non-infective patients. DNA was extracted (MagNA Pure) and added to four tubes containing selected primers and probes for the identification and quantification of all Bac and eight genera by f-real-t PCR. Diagnostic performances based on direct microscopic examination, culture and f-real-t PCR were compared. RESULTS: The f-real-t PCR detected at least 0.01 colony-forming units (CFU) of Bac/microl with no cross-reactivity with fungi. Correlation with culture-positive results was 100%. Sixty per cent of BE samples tested culture-positive, but f-real-t PCR tested positive for 90%. Samples from non-infective cases were negative. CONCLUSION: The f-real-t PCR detected and quantified Bac, Staphylococci, Streptococci, Haemophilus, Pseudomonas, Enterobacteria, Acinetobacter, Propionibacteriacae and Corynebacteria in one run. Cultures required several hours to days (with a non-negligible number of false-negative results) and the f-real-t PCR was completed in 90 min. The f-real-t PCR is presented as a new tool for the diagnosis of BE: its usefulness requires validation with larger series of samples.

Rapid detection and quantification of Propionibacteriaceae.

BACKGROUND: Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Present-day methods of diagnosis for Propioni are unsatisfactory due to a lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties in interpreting SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others). MATERIAL AND METHODS: DNA was extracted using the MagNA Pure isolation kit (Roche), and bacterial detection and quantification were carried out with a set of original primers and probe (5'ATACGTAGGGTGCGAGCGTTGTCC; 5'TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). The PCR cycling programme consisted of one cycle at 95 degrees C, 20 s and 45 cycles at 95 degrees C, 3 s and 30 s at 60 degrees C. DNA extraction yields were assessed in the same tube. RESULTS: This test detects as few as 0.01 Equivalent PFU/microl Propioni in phosphate-buffered saline (PBS), aqueous humour, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells. CONCLUSION: The new real-time PCR is able to detect 0.01 Eq/CFU microl of Propioni suspended in PBS, vitreous, aqueous humour and human cells in less than 1.30 h.

Resistance of Acanthamoeba to classic DNA extraction methods used for the diagnosis of corneal infections.

AIMS: Sensitive diagnosis of Acanthamoeba infections may prevent the clinical condition from becoming worse. In order to improve the diagnosis tool performances, we studied the implication of the DNA extraction procedures on the detection of Acanthamoeba by real-time PCR. METHODS: Acanthamoeba cysts mixed with a tag virus were processed according to different DNA preparation procedures: heat, Proteinase K (ProtK), alkali lysis, QIAmp kit, MagNA Pure (DNA Mini kit, MagNA Pure Nucleic Acid isolation kit), ProtK+QIAmp and ProtK+MagNA Pure. Parasite-DNA loads were assessed by real-time PCR. RESULTS: The results show that the structures of Acanthamoeba cysts are resistant to reagents releasing the DNA from other cells and viruses. Heat, NaOH or ProtK did not allow the DNA extraction yields to be assessed or the inhibitors to be eliminated The QIAmp and the MagNA Pure partially improved the sensitivity of the PCR and eliminated the inhibitors. A significant increase in positive results was obtained with a ProtK treatment before commercial extraction kits. ProtK+MagNA Pure yielded the highest rates of positivity. CONCLUSION: To minimise false negative results, the nucleic-acid based Acanthamoeba diagnosis requires, first, the efficient lysis of cysts (without affecting the DNA) to make the DNA available for extraction and amplification, and, second, the elimination of PCR inhibitors. A significant increase in the detection rates is obtained by adding a ProtK treatment (10 min at 56 degrees C) before the commercial procedures. ProtK+MagNA Pure yielded the best results in 30 min, followed by ProtK+QIAmp (150 min).

Comparison of PCR, microscopic examination and culture for the early diagnosis and characterization of Acanthamoeba isolates from ocular infections.

In the study presented here, PCR, microscopic examination and culture of corneal samples were compared as methods of confirming the clinical diagnosis of Acanthamoeba keratitis, a serious ocular infection that is difficult to diagnose and threatens eyesight. The three methods were applied to isolates obtained from 513 patients with clinical signs or risk factors suggesting Acanthamoeba infection. Acanthamoeba keratitis was diagnosed in 12 of these patients. Combined PCR assays were more sensitive (94%) than either microscopic examination (33%) or culture (7%). The Acanthamoeba isolates were characterized using DNA sequence analysis of the nuclear small-subunit rRNA gene, and T4 was the predominant genotype found.

[Diagnosis of Acanthamoeba spp. keratitis with PCR]. / Diagnostic par PCR des kératites à Acanthamoeba spp.

AIM: Evaluation of a PCR assay as a diagnostic tool for detection of Acanthamoeba spp. in patients presenting infectious keratitis. METHODS: Between August 2001 and November 2002, 342 clinical specimens consisting in corneal scrapings from 334 patients were tested for Acanthamoeba using direct microscopy, culture, and PCR. A fragment of Acanthamoeba 18S rRNA gene was amplified using a set of primers referred to as Nelson's primers. RESULTS: A diagnosis of Acanthamoeba keratitis was considered for nine patients. Amoeba growth in culture was unfruitful for all of these cases. Eight patients had corneal scrapings that tested positive with PCR; in two cases direct microscopy observations confirmed PCR results. For one patient, a negative PCR result was obtained; however, a second corneal sample and cysts staining on May-Grünwald-Giemsa were positive. A false-positive PCR result was noted related to another amebic genus. A risk factor was found in all Acanthamoeba keratitis cases (contact lenses, trauma). Topical treatment was successful, and keratoplasty was necessary afterwards for optical rehabilitation in five patients. CONCLUSION: This study suggests that PCR is a sensitive diagnostic tool, superior to conventional techniques for detecting Acanthamoeba in corneal lesions.

Effects of topical anaesthetics and fluorescein on the real-time PCR used for the diagnosis of Herpesviruses and Acanthamoeba keratitis.

BACKGROUND: The early microbiological diagnosis of corneal infections may prevent the condition from worsening. AIM: To study the potential interferences of oxybuprocain and fluorescein solutions used by ophthalmologists on the performances of the real-time polymerase chain reaction (PCR) carried out as routine test for diagnosis of keratitis. METHODS: Quantified suspensions of Herpes simplex virus (HSV1), Varicella zoster virus (VZV), Cytomegalovirus (CMV) and Acanthamoeba with and without oxybuprocain or fluorescein added before DNA extraction were tested by real-time PCR. RESULTS: The capacities of the real-time PCR to detect HSV, VZV, CMV and Acanthamoeba were reduced by oxybuprocain and fluorescein. Both products diluted to 1/16 reduced the PCR detection capacities for more than 2 logs (DNA copies/sample). CONCLUSIONS: The simultaneous introduction of fluorescein or topical anaesthetics into the tubes containing the specimens to be tested by PCR may lead to false negative results. Because corneal specimens for microbiological diagnosis of keratitis are obtained after topical administration of anaesthetics and corneal staining with fluorescein, ophthalmologists should be aware to rinse the eye surface intensively with appropriate eye solutions to minimise the risks of misdiagnosis.

Detection by broad-range real-time PCR assay of Chlamydia species infecting human and animals.

BACKGROUND: Tests available for molecular diagnosis of chlamydial infections detect Chlamydiatrachomatis, but do not find other Chlamydia species associated with genital, ophthalmic, cardiovascular, respiratory or neurological diseases. The routine detection of all Chlamydia species would improve the prognosis of infected people and guide therapeutic choices. AIM: To design and validate a sensitive, specific, reproducible, inexpensive and easy-to-perform assay to quantify most Chlamydia species. METHODS: Primers and probe were selected using the gene coding for the 16S rRNA. The detection limits were assessed for suspensions of Chlamydia trachomatis, Chlamydia psittaci and Chlamydia pneumoniae. The performance of this test was compared with that of two commercial kits (Amplicor-Roche and Artus) on 100 samples obtained from children with trachoma. RESULTS: The detection capacities for Chlamydia trachomatis of the broad-range real-time polymerase chain reaction (PCR) were similar or slightly better than those obtained with commercial kits (0.2 copies of DNA/microl). Only the broad-range PCR identified specimens containing Chlamydia psittaci and Chlamydia pneumoniae. The commercial kits and the broad-range assay detected Chlamydia species in 5% and in 11%, respectively, of samples from children with trachoma. CONCLUSIONS: This new real-time PCR offers a sensitive, reproducible assay that produces results in <3 h. With panels of quantified Chlamydia species, this real-time PCR can be run with all real-time PCR equipment. Larger trials are needed to confirm the utility of this test in diagnosis and for therapeutic follow-up.

[Proteomic analysis associating two-dimensional electrophoresis and mass spectrometry to identify lacrimal proteins: a case study]. / Apport de l'analyse protéomique associant électrophorèse bi-dimensionnelle et spectrométrie de masse en lacrymologie.

PURPOSE: Identification of a lacrimal protein by proteomic analysis, i.e., two-dimensional electrophoresis and mass spectrometry. MATERIAL AND METHODS: We studied the tears of a 25-year-old female with adrenal gland hyperplasia and hyperandrogenism complaining of chronic dryness and mild bilateral papillary hypertrophy. An allergologic workup was negative. Agarose electrophoresis of the tears showed a bilateral high level of rapid migrated proteins. RESULTS: Dodecyl sulfate polyacrylamide gel electrophoresis of the tears from both eyes showed a highly stained 15-kDa band after Coomassie colloidal blue coloration compared to controls. On two-dimensional electrophoresis, this band focused on a single spot at pI 7.0. After tryptic digestion in gel, peptide mass fingerprint analysis by matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) mass spectrometry provided clear identification of cystatin SN. It is known that mRNA regulated by androgens and encoding glycoproteins homologous to human cystatin exists in the rat lacrimal gland. CONCLUSION: We conclude that the hyperandrogenism of the patient may be cause for the hypersecretion of this cystatin SN, giving an explanation for the high level of rapid migrated proteins (lipocalins). This result provides a concrete example of the proteomic tool used to identify lacrimal proteins, still largely unknown.

[2-year retrospective study of 344 patients presenting for corneal lesion and who were examined for free amebas]. / Etude rétrospective sur deux ans de 344 patients ayant consulté pour une lésion cornéenne et chez lesquels une recherche d'amibes libres a été effectuée.

PURPOSE: The number of cases of amibian keratitis seems to have increased in the XV-XX hospital. Consequently, a study was carried out on 344 patients who came to be treated for keratitis or corneal ulcers over the last two years. METHODS: 28 patients out of 344 showed Acanthamoeba in lens storage cases and/or corneal scrapes. The diagnosis, treatment and clinical evolution of 28 patients were presented. RESULTS: 26/28 patients wore contact lenses, 22 lens cases examined out of 149 (15%) and 7 of corneal scrapes out of 344 (2%) showed the presence of Acanthamoeba. 68% of patients (19 out of 28) came to be treated for the first time in the emergency department. 2/28 patients (7%) were examined at the very beginning of the amibian infection and 24/28 patients (86%) showed the beginnings of stromal infiltration. The diagnosis for 13 of the patients was made within 15 days. 19/28 patients recovered, 1 patient had to undergo a penetrating keratoplasty, 4/28 patients had bacterial infections and 4/28 patients disappeared and we heard nothing more from them. CONCLUSION: Acanthamoeba were isolated from only 7 cornea, whereas 24 patients had an amibian infection. A deep corneal scrape is necessary to avoid a false negative result. A lens storage cases examination is highly recommended.

[Measurement of total IgE in tears : the adaptation of an immunoenzyme technique and the value of investigating locally produced IgE in the diagnosis of chronic conjunctivitis]. / Dosage des IgE totales dans les larmes: adaptation d'une technique immuno-enzymatique et intéret de la recherce d'une syntheèse locale d'IgE dans l'exploration des conjonctivites chroniques.

The measurement of total IgE in tears could be useful to confirm the diagnosis of allergic conjunctivitis, particularly in chronic forms when the etiology is difficult to determine solely on clinical criteria and allergologic anamnesis. Since the level of IgE is normally very low in tears, the adaptation of a fluorescent enzyme immunoassay of total IgE (Unicap, Pharmacia-Upjohn) reduces the detection limit from 0.35 to 0.15 kU/l. Satisfactory results are obtained for accuracy, within-run precision (CV < 5%) and between-run precision (CV < or =11%). During allergic reactions, the local synthesis of IgE is evaluated by the ratio between the measured lacrimal IgE and the lacrimal IgE that have been filtered through the hemato-lacrimal barrier. The serum and tear albumin allows to quantify the permeability of the barrier and thus the amount of filtered tear IgE.

[Amebicide activity of antiseptics and an antibiotic on 2 Acanthamoeba isolated from corneal ulcers]. / Etude de l'activité amoebicide d'antiseptiques et d'un antibiotique sur deux souches d'acanthamoeba isolées d'ulcères de cornée.

PURPOSE: To study the in vitro amoebicidal activity of antiseptics and antibiotics. METHODS: Antiseptics (hexamidine, chlorhexidine, picloxydine, PHMB, polyvidone iodine) and an antibiotic (colimycine) were tested on two Acanthamoeba isolates from corneal ulcers under soft contact lenses. The appearence of trophozoïts and the increase of the number of cysts show their viability. RESULTS: Four antiseptics and colimycin proved to be active in vitro on the two Acanthamoeba isolates: hexamidin 0.1% after 3 to 6 hours incubation, picloxydin 0.05% after 1 to 3 hours incubation (Wilcoxon test, p < 0.05), chlorhexidin 0.02% after 3 hours (Wilcoxon test, p < 0.01), PHBM 0.02% after 3 hours (Wilcoxon test, p < 0.01) and colimycin 125,000 Ul/ml after 1 to 3 hours incubation. Polyvidone iodine proved ineffective. CONCLUSION: Our results confirm that hexamidin, chlorhexidin and PHMB have an amoebicidal activity on the two stains, and show that colimycine, which has already been tested, has also an amoebicidal activity; picloxydine is effective after 1 to 3 hours; there is a considerable variability which exists between the isolates and the sensitivity of the isolates is time-dependent. Medical polytherapy is therefore necessary especially if the sensitivity of the Acanthamoeba has not been tested.

[Protein evaluation of tears: different biological parameters and their respective value]. / Le bilan protéique des larmes: les différents paramètres biologiques et leur intérêt respectif.

PURPOSE: The lacrimal film contains 6 to 10 g/l of proteins, 99% of which locally synthesized by the lacrimal glands. The study of these proteins allows us to explore the lacrimal function and to reveal an inflammatory process. MATERIAL AND METHODS: The lacrimal proteinic profile included the determination of total proteins and electrophoresis on agarose gel and, if necessary, specific determinations of albumin, lactoferrin, lysozyme and immunoglobulins using a nephelemetric technique. Normal values were established on a hundred of individual tears. RESULTS: The electrophoretic proteinic profile may present different abnormalities, such as an inflammatory process, a functional alteration of the lacrimal glands or a dysproteinic abnormality of the tears. The specific determination of the principal lacrimal proteins allows us to accurately quantify each of them. CONCLUSION: The electrophoresis of the tears on an agarose gel reveals the presence of an inflammatory process or the quantitative or qualitative alteration of the lacrimal function. The immuno-nephelemetric determination of the most important proteins which are involved in theses mechanisms gives an accurate quantitative measurement of proteins and allows biological follow-up of the disease.

Biological modifications of the vitreous in intraocular parasitosis: preliminary study.

In intraocular parasitosis the immunologic reactions in the vitrectomy-fluids depend on the parasitic agent: there is a lymphocytical reaction without any IgE production in toxoplasmic chorioretinitis, whereas there is a strong hypersensitivity reaction with a local IgE production as well as the presence of eosinophils and an antigenic stimulation in fluids with toxocara parasitosis. The electrophoretic patterns are quite similar in both cases.